91
|
Addgene inc
position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585 Position Ul39 Test Acgactttgggcttctcaac Ccttgtttgtggtggcctgg Jn555585, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ovol2+plasmid/pmc10588894__pone__0286231__s003-0-159-139?v=Addgene+inc Average 91 stars, based on 1 article reviews
position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585 - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
N/A
|
OVOL2 Human 4 unique 29mer shRNA constructs in lentiviral GFP vector
|
Buy from Supplier |
N/A
|
Ovol2 Mouse 4 unique 29mer shRNA constructs in retroviral untagged vector
|
Buy from Supplier |
N/A
|
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
|
Buy from Supplier |
N/A
|
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
|
Buy from Supplier |
N/A
|
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
|
Buy from Supplier |
N/A
|
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
|
Buy from Supplier |
N/A
|
Ovol2 Rat 4 unique 29mer shRNA constructs in retroviral untagged vector
|
Buy from Supplier |
N/A
|
Full length Clone DNA of Human ovo like zinc finger 2
|
Buy from Supplier |