ovol2 plasmid Search Results


91
Addgene inc position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585
Position Ul39 Test Acgactttgggcttctcaac Ccttgtttgtggtggcctgg Jn555585, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ovol2+plasmid/pmc10588894__pone__0286231__s003-0-159-139?v=Addgene+inc
Average 91 stars, based on 1 article reviews
position ul39 test acgactttgggcttctcaac ccttgtttgtggtggcctgg jn555585 - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

N/A
OVOL2 Human 4 unique 29mer shRNA constructs in lentiviral GFP vector
  Buy from Supplier

N/A
Ovol2 Mouse 4 unique 29mer shRNA constructs in retroviral untagged vector
  Buy from Supplier

N/A
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
  Buy from Supplier

N/A
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
  Buy from Supplier

N/A
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
  Buy from Supplier

N/A
CRISPR/Cas9 KO Plasmids consists of Ovol2-specific 20 nt guide RNA sequences derived from the GeCKO (v2) library. For CRISPR gene knockout, gRNA sequences direct the Cas9 protein to induce a site-specific double strand break (DSB)
  Buy from Supplier

N/A
Ovol2 Rat 4 unique 29mer shRNA constructs in retroviral untagged vector
  Buy from Supplier

N/A
Full length Clone DNA of Human ovo like zinc finger 2
  Buy from Supplier

Image Search Results